ES Cell Details

Order this ES Cell

ES Cell: let-7i (TRE-tight/miR-30)
Stock Number: M000270
Description: This ES cell contains a mature let-7i in miR-30 context controlled by TRE-tight promoter.
Oligonucleotide sequence of mature let-7i in miR-30 context. TGCTGTTGACAGTGAGCGCACAGCACAAACTACTACCTCATAGTGAAGCCACAGATGTATGAGGTAGTAGTTTGTGCTGTTTGCCTACTGCCTCGGA
Validation of ES cells expressing let-7i
- dox
+ dox
Flow cytometric analysis of GFP activity without green fluorescence and then with green fluorescence for the given ES cell
A) Flow cytometric analysis of GFP activity in an ES cell line expressing let-7i in the TRE-tight/miR-30 in the absence of doxycycline (control: left image), and in the presence of doxycycline (right image), plotting cell count (Y-axis) as a function of relative fluorescence (X-axis). GFP expression is demonstrated by the green curve verses the non-GFP-expressing cell population shown in pink. Selected ES cells were grown in 24-well plates in the absence or presence of doxycycline (1 μg/ml) for 48 hours.