Strain Protocols

Strain Information
Strain Code: 01BM1
Strain Name: B6;129S-Blmtm3Brd/Nci
Gene Symbol: Blm
Protocol Information
Allele: Blm<tm3Brd>
Protocol Number: 1
Introductory Comment: The genotyping is performed using real-time PCR copy number technology to determine the copy numbers of Blm exon3 gene. The target gene is detected with a FAM labeled probe and a mouse reference gene, TERT, is detected with a VIC probe. The Blm exon3 primers and probe is shown below: Forward primer: TCTTCTGCAGACTCCCTCAGT; Reverse primer: CAGTGAAGCAAACGCATCTGATG; Probe (FAM/NFQ): ACTGGGCTGATATGGATGACTTT The Blm exon3 gene is determined to be 4 copies per cell.

Primers

Product Sizes

Primer Combination Product Size

Master Mix

Reagent Final Concentration
10X Buffer
25mM MgCl2
2.5mM dNTP Mix
5U/┬Ál Taq Pol
Use 50 - 100 ng of DNA per reaction

Cycling Conditions

(Time in minutes:seconds)
Temperature Time Label
95ºC 10:00
95ºC 0:15
60ºC 1:00 40 Cycles
0ºC
0ºC
0ºC

Disclaimer: PCR conditions were optimized using QIAGEN-purified mouse tail DNA and a PTC-200 thermocycler (MJ Research). Optimal conditions may vary with DNA quality or equipment used.